(b) Alignment of the region proximal to the human VNTR (boxed) in human, rhesus, chimp, rat, and mouse, annotated with the results of a bioinformatics search using the TESS program. transactivate the promoter and increase expression when overexpressed but could not account for the differences in activity between the two alleles of the promoter. Copy number of the insertion sequence was associated with exponentially increasing activity of a downstream promoter, suggesting that the insertion sequence has enhancer activity when present in multiple copies. promoter genotype was found to predict SLC6A1 RNA expression in human postmortem hippocampal samples. These results suggest that the insertion polymorphism leads to increased promoter activity because, in part, of creation of an enhancer element when present as multiple copies. Genotyping individuals from Tanzania in this study suggested that the insertion allele has its origin in Africa. Conclusion On account STMN1 of the effect of the insertion on promoter activity, this relatively common polymorphism may prove useful in predicting clinical response to pharmacological modulators of SLC6A1 as well as GABAergic function in individuals of African descent. gene resides on chromosome 3p25-p24, spans 46.5 kb, and includes 16 exons (Fig. 1). This gene encodes a protein of 599 amino acids with a molecular weight of 67 kDa. The March 2006 genome build shows two transcripts for Dyphylline gene were resequenced in our earlier study [21]. No nonsynonymous SNPs were found but we found a 21-bp insertion polymorphism in the predicted promoter region upstream of exon 1 that creates a second tandem copy of the sequence and therefore creates a variable number of tandem repeats (VNTR) polymorphism. We will refer to this sequence that is present in one or two copies as GAT1-21 (GGGTGGGGAGAGGGAGGGAGG). Open in a separate window Dyphylline Fig. 1 Diagram Dyphylline of the gene structure. Diagram of the human gene showing the location of GAT1-21 that is present in one or two copies that is responsible for the variable number of tandem repeats (VNTR) (hatched) 350 bp 5upstream of exon 1 and the positions of all 16 exons (solid). Alternative exon usage generates transcripts that include exon 1 through 16 or exon 2 through 16. The starting positions of the two major starting transcripts, denoted T1 and T2, are shown. The expression of exons 1 and 2 was verified using publically available whole genome exon expression data (http://www.affymetrix.com/support/technical/sample_data/exon_array_data.affx). In addition, we verified that transcripts originating from exon 1 (T1) and from exon 2 (T2) are in fact expressed using publically available transcriptome sequencing data (http://dbtss.hgc.jp/index.html). These data also support the existence of a transcript originating from within the first intron (not shown in the figure). Here we examine the molecular consequences of this VNTR polymorphism in genotype significantly predicts SLC6A1 expression in hippocampus. We provide evidence that the insertion allele is likely derived from Africa and is unique to individuals in our sample with African ancestry. These results identify a genetic variant that may have important implications for therapeutic response to inhibitors of SLC6A1 as well as GABAergic function in individuals with African ancestry. Materials and methods DNA samples Human DNA samples were obtained in full compliance with Yale and NIH Human Investigation Committee regulations. Cell culture All cell lines were obtained from American Type Culture Collection (ATCC; Manassas, Vermont, USA). Mouse embryonic carcinoma cells (P19) and human embryonic kidney 293 cells (HEK-293) were cultured in Dulbeccos modified Eagle medium (GIBCO invitrogen cell culture, Carlsbad, California, USA). Media were supplemented with 10% fetal bovine serum, 2 U/ml penicillin, 2 g/ml streptomycin, and 2mmol/l L-glutamine (GIBCO invitrogen cell culture). Human neuroblastoma cells [SK-NBE( 2)] were cultured in a 1: 1 mixture of Eagles minimum essential medium and F-12K media (ATCC) supplemented with 10% fetal bovine.